View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4094_high_37 (Length: 244)
Name: NF4094_high_37
Description: NF4094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4094_high_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 6 - 228
Target Start/End: Original strand, 52473057 - 52473279
Alignment:
| Q |
6 |
tctttactttcctagtagttatcccatttttcccccggtttgttcttgaggatactctatttgactgactccatacaaggtttagtcttgacagaaaacc |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
52473057 |
tctttactttcctagtagttatcccatttttcctccggtttgttcttgaggatactctatttgaatgactccatacaaggtttagtcttgacagaaaacc |
52473156 |
T |
 |
| Q |
106 |
caggtctaatcttggcagaaaccccttttttggaacaacctgttgtatggaaatctacaccgttggaaaaaagtttgtcccagaaacataataaggatta |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52473157 |
caggtctaatcttggcagaaaccccttttttggaacaacctgttgtatggaaatctacaccgttggaaaaaagtttgtcccagaaacataataaggatta |
52473256 |
T |
 |
| Q |
206 |
tttcaccaaatcattgctgttaa |
228 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
52473257 |
tttcaccaaatcattgctgttaa |
52473279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University