View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4094_low_31 (Length: 272)
Name: NF4094_low_31
Description: NF4094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4094_low_31 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 11 - 272
Target Start/End: Original strand, 30245755 - 30246017
Alignment:
| Q |
11 |
cataggatcaactcacttaagaaacttcttgtgtcttacaagggcaggcacccagcttgaaatatcttgcaagtataagcgaaatattctgatgcgatgt |
110 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30245755 |
cataggatcaactcacttaagaaaattcttgtgtcttacaagggcaggcacccaccttgaaatatcttgcaagtataagcgaaatattctgatgcgatgt |
30245854 |
T |
|
| Q |
111 |
actgattcaaaattaattcttgagcttttgtctgtttatttattctaatgaagttttgctgcttt-nnnnnnnnntttggtatagagagaaaatgggcag |
209 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
30245855 |
actgattcaaaattaattctcgagcttttgtctgtttatttattctaatgaagttttgctgctttaaaaaaaaaaattggtatagatagaaaatgggcag |
30245954 |
T |
|
| Q |
210 |
ctcaaaataagcaataagtatcatggaaaagttattgtagaacacttgccaagaagggaacac |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30245955 |
ctcaaaataagcaataagtatcatggaaaagttattgtagaacccttgccaagaagggaacac |
30246017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 13 - 103
Target Start/End: Original strand, 30782777 - 30782869
Alignment:
| Q |
13 |
taggatcaactcacttaagaaacttcttgtgtcttacaagggcag--gcacccagcttgaaatatcttgcaagtataagcgaaatattctgat |
103 |
Q |
| |
|
|||||||||| | ||||||||| || |||||| |||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30782777 |
taggatcaacccccttaagaaaattgttgtgttttacaagggcagaggcacccaccttgaaatatcttgcaagtataagcgaaatattctgat |
30782869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University