View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4094_low_37 (Length: 249)
Name: NF4094_low_37
Description: NF4094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4094_low_37 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 9 - 249
Target Start/End: Original strand, 38272442 - 38272684
Alignment:
| Q |
9 |
agcagagagggagaaagacaggagtgataaaaggagaaaaatgaatgaatatattattgcaccgatggtttttgggacttggccattttatttagtagan |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38272442 |
agcagagagggagaaagacaggagtgataaaaggagaaaaatgaatgaatatattattgcaccgatggtttttgggacttggccattttatttagtagat |
38272541 |
T |
|
| Q |
109 |
nnnnnnnn--caacatgaaaagtttgatctaggtgggacccattgttaattatttaactcaaattcttatatgatttgtgtttgtgtgtgaatgtttgtt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38272542 |
ttttttttttcaacatgaaaagtttgatctaggtgggacccattgttaattatttaactcaaattcttatatgatttgtgtttgtgtgtgaatgtttgtt |
38272641 |
T |
|
| Q |
207 |
atcacggtgaatttgtctgaattgttgtagctttttataagat |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38272642 |
atcacggtgaatttgtctgaattgttgtagctttttataagat |
38272684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University