View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4094_low_39 (Length: 248)
Name: NF4094_low_39
Description: NF4094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4094_low_39 |
 |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 6162020 - 6162123
Alignment:
| Q |
1 |
ttaggtttttcttagtcccacatcaattttagagatttgtcactctcttt-----------aatgatgtgacatgtgtgtgttggttttttcattttcca |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6162020 |
ttaggtttttcttagtcccacatcaattttagagatttgtcactctctttaatgatgtggcaatgatgtgacatgtgtgtgttggttttttcattttcca |
6162119 |
T |
 |
| Q |
90 |
tgtc |
93 |
Q |
| |
|
|||| |
|
|
| T |
6162120 |
tgtc |
6162123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 184 - 238
Target Start/End: Original strand, 6162214 - 6162268
Alignment:
| Q |
184 |
gggaacacacgataacccttttattttaaagagttaaatatgttttttgtcccta |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6162214 |
gggaacacacgataacccttttattttaaagagttaaatatgttttttgtcccta |
6162268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000006; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 7 - 63
Target Start/End: Original strand, 19893739 - 19893795
Alignment:
| Q |
7 |
ttttcttagtcccacatcaattttagagatttgtcactctctttaatgatgtgacat |
63 |
Q |
| |
|
|||| |||||||| |||||||||| | ||||||||||||||||||||| |||||||| |
|
|
| T |
19893739 |
tttttttagtcccccatcaattttggtgatttgtcactctctttaatgttgtgacat |
19893795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 239
Target Start/End: Original strand, 14597154 - 14597186
Alignment:
| Q |
207 |
ttttaaagagttaaatatgttttttgtccctat |
239 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
14597154 |
ttttaaagggttaaatatgttttttgtccctat |
14597186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 18 - 77
Target Start/End: Complemental strand, 22909134 - 22909075
Alignment:
| Q |
18 |
ccacatcaattttagagatttgtcactctctttaatgatgtgacatgtgtgtgttggttt |
77 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||| |||||| ||||||||||||| |
|
|
| T |
22909134 |
ccacatcaattttgatgatttgtcactcttattaatgatatgacatatgtgtgttggttt |
22909075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 72
Target Start/End: Complemental strand, 9040406 - 9040341
Alignment:
| Q |
7 |
ttttcttagtcccacatcaattttagagatttgtcactctctttaatgatgtgacatgtgtgtgtt |
72 |
Q |
| |
|
|||| |||||||| |||||| || | |||||||||||||| ||||||||||| ||||| |||||| |
|
|
| T |
9040406 |
tttttttagtcccctatcaatgttggtgatttgtcactctcattaatgatgtggcatgtatgtgtt |
9040341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 239
Target Start/End: Complemental strand, 220224 - 220192
Alignment:
| Q |
207 |
ttttaaagagttaaatatgttttttgtccctat |
239 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
220224 |
ttttaaagggttaaatatgttttttgtccctat |
220192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 23 - 67
Target Start/End: Complemental strand, 33310283 - 33310239
Alignment:
| Q |
23 |
tcaattttagagatttgtcactctctttaatgatgtgacatgtgt |
67 |
Q |
| |
|
|||||||||| |||||||| ||||| ||||||||||| ||||||| |
|
|
| T |
33310283 |
tcaattttagtgatttgtctctctcattaatgatgtgtcatgtgt |
33310239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University