View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4094_low_46 (Length: 241)
Name: NF4094_low_46
Description: NF4094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4094_low_46 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 5 - 234
Target Start/End: Original strand, 38272709 - 38272938
Alignment:
| Q |
5 |
attgtaattctaacaaatatatcaattgtgatatcaaatatgaattgttgacaatgtgatgtttgcgagtaacatgtaatcagctttggaagtgatctgt |
104 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38272709 |
attgtaattctaacaaatctatcaattgtgataccaaatatgaattgttgacaatgtgatgtttgcgagtaacatgtaatcagctttggaaatgatctgt |
38272808 |
T |
 |
| Q |
105 |
caaggtttttattagctctttatattcaatcttatctaaggagctaaaattacggtactttattgtaattatagcaaattcattgtgatatcaaacatac |
204 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38272809 |
caaggtttttgttagctctttatattcaatcttatctaaggagctaaaattgcggtagtttattgtaattatagcaaattcattgtgatatcaaacatac |
38272908 |
T |
 |
| Q |
205 |
accgaatctttgttgacaatatgatgatgt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38272909 |
accgaatctttgttgacaatatgatgatgt |
38272938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University