View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4094_low_47 (Length: 240)
Name: NF4094_low_47
Description: NF4094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4094_low_47 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 20 - 240
Target Start/End: Complemental strand, 11048070 - 11047849
Alignment:
| Q |
20 |
catttagctaacaagttatttattttaggtgtaaacaccttgatacacccgcaaactcaaagtgcagttatgaattaatgtggtaaatttatc-actttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
11048070 |
catttagctaacaagttatttatttttggtgtaaacaccttgatacacccgcaaactcaaagtgcagttatgaattaatgtggtgaatttatctactttt |
11047971 |
T |
 |
| Q |
119 |
atttaaaatctcttatcctctatacggaaactgtacttactctctatatatgttcaatgaatctctactaagcagtgaatatgtataacgcccctttgaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11047970 |
atttaaaatctcttatcctctatacggaaactgtacttactctctatatatgttcaatgaatctctactaagcagtgaatatgtataacgcccctttgaa |
11047871 |
T |
 |
| Q |
219 |
taattttattctccactggatc |
240 |
Q |
| |
|
|||||||||||||| ||||||| |
|
|
| T |
11047870 |
taattttattctcctctggatc |
11047849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University