View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4094_low_53 (Length: 230)
Name: NF4094_low_53
Description: NF4094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4094_low_53 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 9 - 230
Target Start/End: Complemental strand, 8436974 - 8436753
Alignment:
| Q |
9 |
ctatgttatatttttcatgagttgtggagtgaatgtcataatggcgagtactgcactgtaggtgaatagatctttggtataaaatttgcctgaaagctgg |
108 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |||||| |||||||| |
|
|
| T |
8436974 |
ctatattatattttccatgagttgtggagtgaatgtcataatggcgaggactgcactgtaggtgaatagatctttggtttaaaacttgcctcaaagctgg |
8436875 |
T |
|
| Q |
109 |
tttgtgttatttataccaatcttttcacttatagtatggttctcagttcattgtgttaaaacaaaataaatttatcagctttagtactgtagtatcgttg |
208 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8436874 |
tttatgttatttataccaatcttttcacttatagtatggttcccagttcattgtgttcaaacaaaataaatttatcagctttagtactgtagtatcgttg |
8436775 |
T |
|
| Q |
209 |
atggttggttctttaaaatatt |
230 |
Q |
| |
|
|||||||||| ||||||||||| |
|
|
| T |
8436774 |
atggttggttttttaaaatatt |
8436753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 87 - 226
Target Start/End: Complemental strand, 8447462 - 8447323
Alignment:
| Q |
87 |
ataaaatttgcctgaaagctggtttgtgttatttataccaatcttttcacttatagtatggttctcagttcattgtgttaaaacaaa-ataaatttatca |
185 |
Q |
| |
|
|||||||| ||||| |||||||||| |||| ||||| | || | |||||||||||||||||| ||||||||| ||||| | ||| |||||||||||| |
|
|
| T |
8447462 |
ataaaattggcctggaagctggtttttgtt-tttatcctaacgatgtcacttatagtatggttcccagttcattttgttatacaaaatataaatttatca |
8447364 |
T |
|
| Q |
186 |
gctttagtactgtagtatcgttgatggttggttctttaaaa |
226 |
Q |
| |
|
|| |||||||| ||| | |||||||||||||||| ||||| |
|
|
| T |
8447363 |
actgtagtactgcagtgttgttgatggttggttctataaaa |
8447323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University