View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4094_low_57 (Length: 205)
Name: NF4094_low_57
Description: NF4094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4094_low_57 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 33117577 - 33117379
Alignment:
| Q |
1 |
ctcactttacaagttagttttatagagttgtattaaaccaaaccacatattctaatagttctatttcaatcttcattgattccttttcctcacgaagtct |
100 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33117577 |
ctcactttacaaattagttttatggagttgtattaaaccaaaccacttattctaatagttctatttcaatcttgattgattccttttcctcacgaagtct |
33117478 |
T |
 |
| Q |
101 |
ctgtgtttgattttgtatagtgtaattttggagggtaattgcacgggtatcaagtaaagtgtaaaataagagtgactacattaatactcaagtatagtaa |
200 |
Q |
| |
|
|||| ||| |||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33117477 |
ctgtatttaattt------gtataattttggagggtaattgcacgggtatcaagtaaagtgtaaaataagagtgactacattaatactcaagtatagtaa |
33117384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University