View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4095_high_20 (Length: 249)
Name: NF4095_high_20
Description: NF4095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4095_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 8 - 242
Target Start/End: Complemental strand, 26348506 - 26348275
Alignment:
| Q |
8 |
catcatcactcacaagtttcttttggttgttagcaaaaaatccagaagttgagaaagagattttgttagaagcagaaagagtaattggaccacatgatga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26348506 |
catcatcactcacaagtttcttttggttattagcaaaaaatccagaagttgagaaagagattttgttagaagcagaaagagtaattggaccacatgatga |
26348407 |
T |
 |
| Q |
108 |
tgaaaacaatatttttggtgtaacgaattttgaacaacttaggaaattgcattatttacaagcagcagcacatgaaagtatgagactatatccaccaatt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26348406 |
---aaacaatatttttggtgtaacgaattttgaacaacttaggaaattgcattatttacaagcagcagcacatgaaagtatgagactatatccaccaatt |
26348310 |
T |
 |
| Q |
208 |
caatttgattcaaagttttgtttggatgatgatgt |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
26348309 |
caatttgattcaaagttttgtttggatgatgatgt |
26348275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University