View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4095_high_24 (Length: 238)
Name: NF4095_high_24
Description: NF4095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4095_high_24 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 45165356 - 45165136
Alignment:
| Q |
18 |
atagactcaaacaactcccttgcgatgtccattttcttagtttgcacataacccgcaatcattgcattgtatgaaacttcatttttctcaggcatttcat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
45165356 |
atagactcaaacaactcccttgcgatgtccattttcttagtttgcacataacccgcaatcattgcattgtatgaaacttcatttttctcaggcatttcgt |
45165257 |
T |
|
| Q |
118 |
cnnnnnnngttttagcttcatccagcattccattctgcacatatccagacaccatagctgtccatgtgaacacgtcccgtgttggagactcgtcaaacaa |
217 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45165256 |
caaaaaaagttttagcttcatccagcattccattctgcacatatccagacaccatagctgtccatgtgaacacgtcccgtgttggagactcgtcaaacaa |
45165157 |
T |
|
| Q |
218 |
tctcctggcctgtgacaaacc |
238 |
Q |
| |
|
|||||| |||||||||||||| |
|
|
| T |
45165156 |
tctcctcgcctgtgacaaacc |
45165136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 132 - 236
Target Start/End: Complemental strand, 45148881 - 45148777
Alignment:
| Q |
132 |
gcttcatccagcattccattctgcacatatccagacaccatagctgtccatgtgaacacgtcccgtgttggagactcgtcaaacaatctcctggcctgtg |
231 |
Q |
| |
|
|||||||||| ||||||| ||||||||||| || ||||||| |||||||| ||||| || ||||| |||||||| |||||||| |||||||| ||| |
|
|
| T |
45148881 |
gcttcatccaacattccactctgcacatatgcaaacaccattgctgtccacgtgaaaacatcccgcaccggagactcctcaaacaacctcctggcttgta |
45148782 |
T |
|
| Q |
232 |
acaaa |
236 |
Q |
| |
|
||||| |
|
|
| T |
45148781 |
acaaa |
45148777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University