View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4095_high_29 (Length: 211)
Name: NF4095_high_29
Description: NF4095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4095_high_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 17 - 194
Target Start/End: Original strand, 7605907 - 7606084
Alignment:
| Q |
17 |
aatagaaaccctaattagatagttgtcatcagagactcttgttgataaattatgatatgatttttatcacatgatcctgattgtgtctttagacttattt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7605907 |
aatagaaaccctaattagatagttgtcatcagagtctcttgttgataaattaggatatgatttttatcacatgatcctgattgtgtctttagacttattt |
7606006 |
T |
|
| Q |
117 |
gaatatggtctagggcatctcgatagcataatatgcggtagcctgctatcttgatgcaaactcattcttttgttggat |
194 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||| |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7606007 |
gaatatggtctaggacatctcgataacataatatgtggtagcttgctatcttgatgcaaactcattcttttgttggat |
7606084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University