View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4095_high_4 (Length: 448)
Name: NF4095_high_4
Description: NF4095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4095_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 415; Significance: 0; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 415; E-Value: 0
Query Start/End: Original strand, 17 - 443
Target Start/End: Original strand, 46599016 - 46599442
Alignment:
| Q |
17 |
caccattccccggaggagcaagagtcaacgcagtcaacggatcatcttccaccggaaaagtaaactgaccaccttcgttgccacctccagcaaccgtaac |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46599016 |
caccattccccggaggagcaagagtcaacgcggtcaacggatcatcttccaacggaaaagtaaactgaccaccttcgttgccacctccagcaaccgtaac |
46599115 |
T |
 |
| Q |
117 |
agaaccaccacaacccgctctacgcttaagcgtagagttccaatgattcttgacagcattatcagttctaccaggtaaaagccttgcaatggtagcccaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46599116 |
agaaccaccacaacccgctctacgcttaagcgtagagttccaatgattcttgacagcattatcagttctaccaggtaaaagccttgcaatggtagcccaa |
46599215 |
T |
 |
| Q |
217 |
cggttaccatattgagcatgcgccgctatgattgtttcatcttcttgtgaagaaaatggacggtgttccacggtgggactcagctgattacaccaccgga |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46599216 |
cggttaccatattgagcatgcgccgctatgattgtttcatcttcttgtgaagaaaatggacggtgttccacggtgggactcagctgattacaccaccgga |
46599315 |
T |
 |
| Q |
317 |
gacgacatgacttgccggaacgaccttttatgtagcggctgatgagtgaccagtttcttgctccatgttgttcaaccagtcgtgttaaaattctgtcttc |
416 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46599316 |
gacgacatgacttgccggaacgaccttttatgtagcggctgatgagtgaccagtttcttgctccatgttgttcaaccagtcgtgttaaaattctgtcttc |
46599415 |
T |
 |
| Q |
417 |
ttctgcactccatggacctttgcttct |
443 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
46599416 |
ttctgcactccatggacctttgattct |
46599442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 156 - 203
Target Start/End: Original strand, 40752008 - 40752055
Alignment:
| Q |
156 |
ccaatgattcttgacagcattatcagttctaccaggtaaaagccttgc |
203 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
40752008 |
ccaatgattcttcacagcattatcagttctaccagggaaaagtcttgc |
40752055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 286 - 341
Target Start/End: Complemental strand, 35748041 - 35747986
Alignment:
| Q |
286 |
acggtgggactcagctgattacaccaccggagacgacatgacttgccggaacgacc |
341 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||| ||||| || || |||||||| |
|
|
| T |
35748041 |
acggttggactcagctgattacaccaccgtagacggcatgattttcctgaacgacc |
35747986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 160 - 206
Target Start/End: Original strand, 31791021 - 31791067
Alignment:
| Q |
160 |
tgattcttgacagcattatcagttctaccaggtaaaagccttgcaat |
206 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||| |||||||| ||||| |
|
|
| T |
31791021 |
tgattcttaacagcattatcagttcttccagggaaaagcctagcaat |
31791067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University