View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4095_low_30 (Length: 236)
Name: NF4095_low_30
Description: NF4095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4095_low_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 17 - 222
Target Start/End: Original strand, 45692205 - 45692412
Alignment:
| Q |
17 |
gaaatgaggagcgagtgggatgcctagtgtgtttaaaaagacacgactcaagcaaaataagattttatcgtacaagtaggtatgtcggtaaaatatgaac |
116 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45692205 |
gaaaggaggagcgagtgggatgcctaatgtgtttaaaaagacatgactgaagcaaaataagattttatcgtacaagtaggtatgtcggtaaaatatgaac |
45692304 |
T |
 |
| Q |
117 |
acttgtgtatcataaaaatgttgtggtggatgattgtagaaatcatacatgagataagattatgaatgatagc--tagagtaggaatgtcaccaatgcaa |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45692305 |
acttgtgtatcataaaaatgttgtggtggatgattgtagaaatcatacatgagataagattatgaatgatagcaatagagtaggaatgtcaccaatgcaa |
45692404 |
T |
 |
| Q |
215 |
aattattg |
222 |
Q |
| |
|
|||||||| |
|
|
| T |
45692405 |
aattattg |
45692412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University