View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4095_low_31 (Length: 236)
Name: NF4095_low_31
Description: NF4095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4095_low_31 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 68 - 230
Target Start/End: Complemental strand, 30360908 - 30360746
Alignment:
| Q |
68 |
tccttttataatgtttgattatcgtgaacagtgctggatggtgtggtgatgtgttactgctacgtgtttgcagcttaagtattgttggtgcaagtgtcgt |
167 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | |
|
|
| T |
30360908 |
tccttttataatgtttggttatcgtgaacagtgctggattgtgtggtgatgtgttactgctacgtgtttgcagcttaagtattattggtgcaagtgtctt |
30360809 |
T |
|
| Q |
168 |
acttgctttggcggtttgacatgtgtcttgtctctttttattccttgctttatttgatgatgt |
230 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30360808 |
acttgctttggcagtttgacatgtgtcttgtctctttttattccttgctttattttatgatgt |
30360746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 89 - 165
Target Start/End: Complemental strand, 30356297 - 30356219
Alignment:
| Q |
89 |
tcgtgaacagtgctggatggtgt-ggtgatgtgttactgctacgtgtttgcagc-ttaagtattgttggtgcaagtgtc |
165 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||| || ||| ||||||||| |||||||| ||||| |
|
|
| T |
30356297 |
tcgtgaacagtgctggatgggttcggtgatgtgttactgctacgtgtctgtagctttaagtattattggtgcaggtgtc |
30356219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University