View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4095_low_32 (Length: 229)
Name: NF4095_low_32
Description: NF4095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4095_low_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 6 - 137
Target Start/End: Original strand, 30902698 - 30902829
Alignment:
| Q |
6 |
aggagagcggcgaggatgacgacgaagtcggattctaatgaggcggcggagtccggcggtggtgcggcggaggaaatggattgtaataatattctagtca |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30902698 |
aggagagcggcgaggatgacgacgaagtcggattctaatgaggcggcggagtccggcggtggtgcggcggaggaaatggattgtaataatattctagtca |
30902797 |
T |
 |
| Q |
106 |
tgttattaggaaaatgtttgtttttaataatt |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30902798 |
tgttattaggaaaatgtttgtttttaataatt |
30902829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 177 - 213
Target Start/End: Original strand, 30902874 - 30902910
Alignment:
| Q |
177 |
tgttatgttgtgttgtgttttgggaagttgaataatt |
213 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30902874 |
tgttgtgttgtgttgtgttttgggaagttgaataatt |
30902910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University