View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4095_low_7 (Length: 385)
Name: NF4095_low_7
Description: NF4095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4095_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 10 - 367
Target Start/End: Original strand, 54786589 - 54786945
Alignment:
| Q |
10 |
agaacctgtgttgcacagggttggaggtggaaggtatacttgggatccaaaaattaacttcacaaattgggcaagtaatgagcacttttatcagggtgat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
54786589 |
agaacctgtgttgcacagggttggaggtggaaggtatacttgggatccaaaaattaacttcacaaattgggcaagtaatgagcacttttaccagggtgat |
54786688 |
T |
|
| Q |
110 |
tggctatgtaagttcgttccttcctgacacatgttgattaatatcattgcaaataatttatttattattaactgaagtgaattctcttttttgtaaatag |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54786689 |
tggctatgtaagttcgttccttcctgacacatgttgattaatatcattgcaaata-tttatttattattaactgaagtgaattctcttttttgtaaatag |
54786787 |
T |
|
| Q |
210 |
attttggttttgataagcacatctataatgttcttgaggtgaacaaaacaaattatgagaaatgtgttgataagggcttcataagcaacatcacgagagg |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54786788 |
attttggttttgataagcacatctataatgttcttgaggtgaacaaaacaaattatgagaaatgtgttgataagggcttcataagcaacatcacgagagg |
54786887 |
T |
|
| Q |
310 |
aggaagagatgttttccaactattagaggcaaagacatattactttctatgtggtaga |
367 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
54786888 |
aggaagagatgttttccaactcttagaggcaaagacatattactttctatgtggtaga |
54786945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University