View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4095_low_8 (Length: 366)
Name: NF4095_low_8
Description: NF4095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4095_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 132; Significance: 2e-68; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 13 - 148
Target Start/End: Original strand, 11484813 - 11484948
Alignment:
| Q |
13 |
atgaacaaacttgagaagatgcgcaacttgttcaacttgttggcaaaagacctttgaatctaaatgtgtagattcattcatattagtccaatagaataag |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
11484813 |
atgaacaaacttgagaagatgcgcaacttgttcaacttgttggcaaaagacctttgaatctaaatgtttagattcattcatattagtccaatagaataag |
11484912 |
T |
 |
| Q |
113 |
tttaaagttgatttagcctattaaaaatataggtaa |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
11484913 |
tttaaagttgatttagcctattaaaaatataggtaa |
11484948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 243 - 366
Target Start/End: Original strand, 11485077 - 11485200
Alignment:
| Q |
243 |
tctctgaaaaaatatttagtttggttgcataggcttttattattannnnnnngtctatgtattgttcccatattctctatgatattcaacttgatacctc |
342 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |||||| |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11485077 |
tctctgaaaaaatatttagtttggttggataggctttctttattatttttttgtctatgtattgttcccatattctctatgatattcaacttcgtacctc |
11485176 |
T |
 |
| Q |
343 |
gtatatatgtttgagggtgtgtct |
366 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
11485177 |
gtatatatgtttgagggtgtgtct |
11485200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 181 - 241
Target Start/End: Original strand, 11484981 - 11485041
Alignment:
| Q |
181 |
gacaatttgatatagtaaaactcattcatacattccaccaaatactatatatttagttttg |
241 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11484981 |
gacaatttgatatagtaaaactctttcatacattccaccaaatactatatatttaattttg |
11485041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University