View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4096_low_3 (Length: 275)
Name: NF4096_low_3
Description: NF4096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4096_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 13 - 135
Target Start/End: Complemental strand, 29641374 - 29641252
Alignment:
| Q |
13 |
aatataaaagaattttacaccgtcatcaactatgtttatgtggcattgtttgattttgcgtcttattgtggtattggtttttaacttatgggatattgtt |
112 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
29641374 |
aatataaaagaattttacaccatcatcaactatgtttatgtgacattgtttgattttacgtcttattgtggtattggtttttaacttacgggttattgtt |
29641275 |
T |
 |
| Q |
113 |
tatgtatgaattgtctacctcaa |
135 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
29641274 |
tatgtatgaattgtctacctcaa |
29641252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 165 - 262
Target Start/End: Complemental strand, 29641229 - 29641132
Alignment:
| Q |
165 |
tgtgtccatatattggtaccactcttttgagataatgttttagtacatataatcatgtaattgctaaatgttactgattgcaattcaaccacatatgt |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29641229 |
tgtgtccatatattggtaccactcttttgagataatgttttagtacatataatcatgtaattgctaaatgttactgattgcaattcaaccacatatgt |
29641132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University