View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4096_low_3 (Length: 275)

Name: NF4096_low_3
Description: NF4096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4096_low_3
NF4096_low_3
[»] chr2 (2 HSPs)
chr2 (13-135)||(29641252-29641374)
chr2 (165-262)||(29641132-29641229)


Alignment Details
Target: chr2 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 13 - 135
Target Start/End: Complemental strand, 29641374 - 29641252
Alignment:
13 aatataaaagaattttacaccgtcatcaactatgtttatgtggcattgtttgattttgcgtcttattgtggtattggtttttaacttatgggatattgtt 112  Q
    ||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| ||| |||||||    
29641374 aatataaaagaattttacaccatcatcaactatgtttatgtgacattgtttgattttacgtcttattgtggtattggtttttaacttacgggttattgtt 29641275  T
113 tatgtatgaattgtctacctcaa 135  Q
    |||||||||||||||||||||||    
29641274 tatgtatgaattgtctacctcaa 29641252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 165 - 262
Target Start/End: Complemental strand, 29641229 - 29641132
Alignment:
165 tgtgtccatatattggtaccactcttttgagataatgttttagtacatataatcatgtaattgctaaatgttactgattgcaattcaaccacatatgt 262  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29641229 tgtgtccatatattggtaccactcttttgagataatgttttagtacatataatcatgtaattgctaaatgttactgattgcaattcaaccacatatgt 29641132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University