View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4097_high_26 (Length: 250)
Name: NF4097_high_26
Description: NF4097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4097_high_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 9 - 242
Target Start/End: Complemental strand, 43157621 - 43157387
Alignment:
| Q |
9 |
gattatactaa-gtgtatcatttgcttcaagaggtcttatagattcgatcttcgaccctatttataaaatattgaataaaagacatgttgatatgaagtt |
107 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| ||||||||| || |
|
|
| T |
43157621 |
gattatactaaagtgtatcatttgcttcaagaggtcttatagattccatcttcgaccctatttgtaaaatattgaataaaagacatgctgatatgaattt |
43157522 |
T |
 |
| Q |
108 |
aagagtttgattgagtttatcgcaacattcctttaatcaacttgaagtaatcatatttgaggtgtgttgaatnnnnnnngtgtgtatatcatacattcaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |||||| |
|
|
| T |
43157521 |
aagagtttgattgagtttatcgcaacattcctttaatcaacttgaagtaatcatatttgaggtgtgttgaataaaaaaagtgtgtatctcatatattcaa |
43157422 |
T |
 |
| Q |
208 |
gattgagctttgatttgtcacattgtaagaatcta |
242 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
43157421 |
gattgagctttgatttgtcacattgtgagaatcta |
43157387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University