View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4097_high_27 (Length: 249)
Name: NF4097_high_27
Description: NF4097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4097_high_27 |
 |  |
|
| [»] scaffold0285 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 19 - 102
Target Start/End: Original strand, 17962857 - 17962940
Alignment:
| Q |
19 |
accatctgtgttcaccttaacccagttgaaaattggaggaaaccagataacttcaataactctaggggcatttggaggcttgat |
102 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17962857 |
accatcagtgttcaccttaacccagtcaaaaattggaggagtccagataacttcaataactctaggggcattaggaggcttgat |
17962940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 19 - 102
Target Start/End: Original strand, 815546 - 815629
Alignment:
| Q |
19 |
accatctgtgttcaccttaacccagttgaaaattggaggaaaccagataacttcaataactctaggggcatttggaggcttgat |
102 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
815546 |
accatcagtgttcaccttaacccagtcaaaaattggaggagtccagataacttcaataactctaggggcattaggaggcttgat |
815629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 19 - 102
Target Start/End: Original strand, 28688395 - 28688478
Alignment:
| Q |
19 |
accatctgtgttcaccttaacccagttgaaaattggaggaaaccagataacttcaataactctaggggcatttggaggcttgat |
102 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28688395 |
accatcagtgttcaccttaacccagtcaaaaattggaggagtccagataacttcaataactctaggggcattaggaggcttgat |
28688478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0285 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0285
Description:
Target: scaffold0285; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 20 - 72
Target Start/End: Original strand, 14821 - 14873
Alignment:
| Q |
20 |
ccatctgtgttcaccttaacccagttgaaaattggaggaaaccagataacttc |
72 |
Q |
| |
|
||||| ||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
14821 |
ccatcagtgttcaccttaatccaattgaaaattggaggaaaccagataacttc |
14873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University