View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4097_low_22 (Length: 285)
Name: NF4097_low_22
Description: NF4097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4097_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 5e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 39 - 268
Target Start/End: Complemental strand, 34714014 - 34713783
Alignment:
| Q |
39 |
tctaggacacaaggagcataacttatctattaatttctctatcctcataatttctaattctactatgacaatgcatccttgcattttcttcttctctcaa |
138 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||| | || |||||||||||||||||| ||| |||||||||||||||||||||| |||||||| || |
|
|
| T |
34714014 |
tctaggccacaaggagcataacttatctcttaatttatttaccctcataatttctaattccactgtgacaatgcatccttgcatttttctcttctctaaa |
34713915 |
T |
 |
| Q |
139 |
aaa--tcatcatgtgaaatccaaatcattcatccttatcgagtaaagtggtagtagtcatttcgtttgtagtatataagtaccatgcatttacgttaaga |
236 |
Q |
| |
|
||| ||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34713914 |
aaacctcatcatgtgaaatccataccattcatccttatcgagtaaagtggtagtagtcatttcgtttgtagtatataagtaccatgcatttacgttaaga |
34713815 |
T |
 |
| Q |
237 |
atgttttactattttaaaaattatatacccaa |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
34713814 |
atgttttactattttaaaaattatatacccaa |
34713783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University