View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4097_low_8 (Length: 408)
Name: NF4097_low_8
Description: NF4097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4097_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 67; Significance: 1e-29; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 5 - 75
Target Start/End: Complemental strand, 21207734 - 21207664
Alignment:
| Q |
5 |
gaggagcagagataacatatttaacactctttataataagacaattgatagcgcgagaaagtgtcgtatgc |
75 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21207734 |
gaggagcagaaataacatatttaacactctttataataagacaattgatagcgcgagaaagtgtcgtatgc |
21207664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 219 - 267
Target Start/End: Complemental strand, 37927589 - 37927541
Alignment:
| Q |
219 |
gaagaatgacattaatggttgttaaagtttcaaacaattgttaaatatc |
267 |
Q |
| |
|
||||| |||| || || |||||||||||||||||||||| ||||||||| |
|
|
| T |
37927589 |
gaagagtgacgttgatcgttgttaaagtttcaaacaatttttaaatatc |
37927541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University