View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4098_high_9 (Length: 354)
Name: NF4098_high_9
Description: NF4098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4098_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 11 - 337
Target Start/End: Original strand, 38225406 - 38225732
Alignment:
| Q |
11 |
cagagattatccaagtattaaagagaatggtctttgaagtctcttcaagtactttattggtggaaagatgtaaaatcaaggaaagaatgccaatgacgaa |
110 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38225406 |
cagagattatacaagtattaaagagaatggtctttgaagtctctttaagtactttattggtggaaagatgtaaaatcaaggaaagaatgccaatgacgaa |
38225505 |
T |
 |
| Q |
111 |
gagactttcttgacttaagatatctgcctcttttgatggaatagagtactccatcatctgcagaagtggtacgtgctgttagaactacaaaaattattga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38225506 |
gagactttcttgacttaagatatctgcctcttttgatggaatagagtactccatcatctgcagaagtggtacgtgctgttagaactacaaaaattattga |
38225605 |
T |
 |
| Q |
211 |
ccgaatctccaaattttctagtaagattccctatgcttgctatggaattattgtggatatattgcagcatcagaacacaatatttgcattccacttcatc |
310 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38225606 |
ccgaatctccaaattttctagtgagattccctatgcttgctatggaattattgtggatatattgcagcatcagaacacaatatttgcattccacttcatc |
38225705 |
T |
 |
| Q |
311 |
tctacctattttatagtccacgatttt |
337 |
Q |
| |
|
||||||||||||||||||||| ||||| |
|
|
| T |
38225706 |
tctacctattttatagtccacaatttt |
38225732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University