View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4098_low_15 (Length: 274)
Name: NF4098_low_15
Description: NF4098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4098_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-138; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 7 - 265
Target Start/End: Complemental strand, 3219968 - 3219712
Alignment:
| Q |
7 |
gcacggatataattttgttgcagaaagggccgctggaaagccgcaaggtgaggatggcagtctggaagttgtagaaagtccccctggaaaggttgcagaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3219968 |
gcacggatataattttgttgcagaaagggccgctggaaagccgcaaggtgaggatggcagtctggaagttgtagaaagtccccctggaaaggttgcagaa |
3219869 |
T |
|
| Q |
107 |
agagccattggaaagccgcaagtggggggaaatgatgatattgcaaaaagtttagaattttttacatgagctttactgcagcgctatctgaccactatca |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3219868 |
agagccattggaaagccgcaagtggggggaaatgatgatattgcaaaaagtttagaa--ttttacatgagctttactgcagcgctatctgaccactatca |
3219771 |
T |
|
| Q |
207 |
gtagtgctactctaaacttcaatgcaaaatggggtttcgtcgtgtcgcacccatgagcc |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3219770 |
gtagtgctactctaaacttcaatgcaaaatggggtttcgtcgtgtcgcacccatgagcc |
3219712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 7 - 64
Target Start/End: Original strand, 15985620 - 15985677
Alignment:
| Q |
7 |
gcacggatataattttgttgcagaaagggccgctggaaagccgcaaggtgaggatggc |
64 |
Q |
| |
|
||||||||| ||||||||| ||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
15985620 |
gcacggatagcattttgttgtagaaagggctgctggaaagccacaaggtgaggatggc |
15985677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 206 - 243
Target Start/End: Original strand, 15985932 - 15985969
Alignment:
| Q |
206 |
agtagtgctactctaaacttcaatgcaaaatggggttt |
243 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15985932 |
agtagcgctactctaaacttcaatgcaaaatggggttt |
15985969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 93 - 148
Target Start/End: Original strand, 15985684 - 15985738
Alignment:
| Q |
93 |
gaaaggttgcagaaagagccattggaaagccgcaagtggggggaaatgatgatatt |
148 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||| |||||||| ||||||||| |
|
|
| T |
15985684 |
gaaaggttgcagaaagggccaatggaaagccgcaag-agggggaaacgatgatatt |
15985738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University