View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4098_low_5 (Length: 478)
Name: NF4098_low_5
Description: NF4098
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4098_low_5 |
 |  |
|
| [»] scaffold0095 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 264 - 469
Target Start/End: Original strand, 44289941 - 44290146
Alignment:
| Q |
264 |
aatggaatgatgcccttttgatttatttgttgtgattctgaaaatctgctatctgggttgtggaaagttttaatttttagtggaatggataggtttttga |
363 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44289941 |
aatggaatgatgcccttttgatttatttgctgtgattctgaaaatctgctatctgggttgtggaaagttttaatttttagtggaatggataggtttttga |
44290040 |
T |
 |
| Q |
364 |
gtttgtgtggttatggattgatgttgatcttttttcagctggaaatgttgtttgctcgtggggtagaggagaggatggacaattaggtcatggtgatact |
463 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44290041 |
gtttgtgtggttatggattgatgttgatcttttttcagctggaaatgttgtttgctcgtggggtagaggagaggatggacaattaggtcatggtgatact |
44290140 |
T |
 |
| Q |
464 |
gatgat |
469 |
Q |
| |
|
|||||| |
|
|
| T |
44290141 |
gatgat |
44290146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 144; E-Value: 2e-75
Query Start/End: Original strand, 18 - 165
Target Start/End: Original strand, 44289695 - 44289842
Alignment:
| Q |
18 |
gaaactgtttactgtaaaggacaatcatgcaggaggttgaagccaccaccgcttctccgcctccaccccgccgtgttcttcttatatctgctggtggtag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44289695 |
gaaactgtttactgtaaaggacaatcatgcaggaggttgaagccaccaccgcttctccgcctccaccccgccgtgttcttcttatatctgctggtggtag |
44289794 |
T |
 |
| Q |
118 |
ccactctgttgctcttatctgtaagctcaataccacaaaacgcttaac |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44289795 |
ccactctgttgctcttatctgtaagctcaataccacaaaaagcttaac |
44289842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 296 - 350
Target Start/End: Original strand, 44289895 - 44289949
Alignment:
| Q |
296 |
tgattctgaaaatctgctatctgggttgtggaaagttttaatttttagtggaatg |
350 |
Q |
| |
|
||||||||||||||||| || ||||||||| ||||||| |||||||| ||||||| |
|
|
| T |
44289895 |
tgattctgaaaatctgccatttgggttgtgaaaagtttgaatttttaatggaatg |
44289949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0095 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 2)
Name: scaffold0095
Description:
Target: scaffold0095; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 399 - 469
Target Start/End: Complemental strand, 20128 - 20058
Alignment:
| Q |
399 |
cagctggaaatgttgtttgctcgtggggtagaggagaggatggacaattaggtcatggtgatactgatgat |
469 |
Q |
| |
|
||||||| |||||||||||||| ||||| ||||||| || ||||||||||| ||||||||||| |||||| |
|
|
| T |
20128 |
cagctggcaatgttgtttgctcttggggccgaggagaagacggacaattaggccatggtgataccgatgat |
20058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0095; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 91 - 129
Target Start/End: Complemental strand, 29185 - 29147
Alignment:
| Q |
91 |
tgttcttcttatatctgctggtggtagccactctgttgc |
129 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
29185 |
tgttcttcttatatctgctggtgctagccacactgttgc |
29147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 399 - 469
Target Start/End: Original strand, 39411653 - 39411723
Alignment:
| Q |
399 |
cagctggaaatgttgtttgctcgtggggtagaggagaggatggacaattaggtcatggtgatactgatgat |
469 |
Q |
| |
|
||||||| |||||||||||||| ||||| ||||||| || ||||||||||| ||||||||||| |||||| |
|
|
| T |
39411653 |
cagctggcaatgttgtttgctcttggggccgaggagaagacggacaattaggccatggtgataccgatgat |
39411723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 91 - 143
Target Start/End: Original strand, 39410626 - 39410678
Alignment:
| Q |
91 |
tgttcttcttatatctgctggtggtagccactctgttgctcttatctgtaagc |
143 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||||| ||| || |||||| |
|
|
| T |
39410626 |
tgttcttcttatatctgctggtgctagccacactgttgcacttctcagtaagc |
39410678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University