View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4100_low_10 (Length: 243)
Name: NF4100_low_10
Description: NF4100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4100_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 13 - 225
Target Start/End: Complemental strand, 46462208 - 46461993
Alignment:
| Q |
13 |
cataggtcataaattatttgctcagtataaatttaaaaatgatagttccaacaaatttaggctcaagaaatgcggaagcaagaagaagaaatagagagaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46462208 |
cataggtcataaattatttgctcagtataaatttaaaaatgatagttccaacaaatttaggctcaagaaatgcggaagcaagaagaagaaatagagagaa |
46462109 |
T |
|
| Q |
113 |
tccagttcatattgcagagccctgctcagcttcagcaatatggggctgaaactcaag---gtgttaatggcaatgttctctgtcccataaacaatgctcc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
46462108 |
tccagttcatattgcagagccctgctcagcttcagcaatatggggctgaaactcaagaaagtgttaatggcattgttctctgtcccataaacaatgctcc |
46462009 |
T |
|
| Q |
210 |
tatggtgaggcagaac |
225 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
46462008 |
tatggtgaggcagaac |
46461993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University