View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4102_high_4 (Length: 381)
Name: NF4102_high_4
Description: NF4102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4102_high_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 22 - 343
Target Start/End: Complemental strand, 423284 - 422960
Alignment:
| Q |
22 |
catcatcatcattataattatttgttgtaatcaattcccttttatattactatggacttgaatttgattgctctgcgtttcctttttccgtaggtggctc |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
423284 |
catcatcatcattataattatttgttgtaatcaattcccatttatattactatggacttgaatttgattgctctgcgtttcctttttccgtaggtggctc |
423185 |
T |
|
| Q |
122 |
ctcggaataccattggagaggtccctttgaagtggtatgaggatgaaccccatattggatatgacatcaaggggaagaagattaagaagaaagaaaggga |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
423184 |
ctcggaataccattggagaggtccctttgaagtggtatgaggatgaaccccatattggatatgacatcaaggggaagaagattaagaagaaagaaaggga |
423085 |
T |
|
| Q |
222 |
agacaaattgggttcctttcttgcaaatgttgacgattctaagaattggttagtttcatatatctatattaac---ttgtctctatttccattttcatta |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
423084 |
agacaaattgggttcctttcttgcaaatgttgatgattctaagaattggttagtttcatatatctatattaacttgttgtctctatttccattttcatta |
422985 |
T |
|
| Q |
319 |
ttgcattccttttgtactcactgac |
343 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
422984 |
ttgcattccttttgtactcactgac |
422960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University