View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4103_high_6 (Length: 223)
Name: NF4103_high_6
Description: NF4103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4103_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 5 - 205
Target Start/End: Original strand, 41744363 - 41744563
Alignment:
| Q |
5 |
tcgagtgagatgaatactattagccctaaaagttcatatccttctcaagcattaatgaatcctagaagaagtagttctaatggtattggtgtgatagaga |
104 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41744363 |
tcgagtgcgaagaatactattagccctaaaagttcatatccttctcaagcattaatgagtcctagaagaagtagttctaatggtattggtgtgatagaga |
41744462 |
T |
 |
| Q |
105 |
aggtgaaaggagctgtgaattcttttctaagaaatgatgaacaaccacaacagaaaaatgttgtaaaaaatcctataacacatactaattcttcacaaag |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41744463 |
aggtgaaaggagctgtgaattcttttctaagaaatgatgtacaaccacaacagaaaaatgttgtaaaaaatcctataacacatactaattcttcacaaag |
41744562 |
T |
 |
| Q |
205 |
a |
205 |
Q |
| |
|
| |
|
|
| T |
41744563 |
a |
41744563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University