View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4103_low_3 (Length: 462)
Name: NF4103_low_3
Description: NF4103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4103_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 4e-88; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 4e-88
Query Start/End: Original strand, 115 - 290
Target Start/End: Original strand, 35967888 - 35968064
Alignment:
| Q |
115 |
taattttgttttgggacgtgggaaaccatggc-gaaggcaattccaaagggtgtttggtacggcaacactttaagaaaaattgcgtcaacgcggaagctg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35967888 |
taattttgttttgggacgtgggaaaccatggccgaaggcaattccaaagggtgtttggtacggcaacactttaagaaaaattgcggcaacgcggaagctg |
35967987 |
T |
 |
| Q |
214 |
tattgtatagcttctctgttttcaagttaataatgcattgcggccgtgaatccaaataggtgctaaaagagtaccac |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35967988 |
tattgtatagcttctctgttttcaagttaataatgcattgcggccgtgaatccaaataggtgctaaaagagtaccac |
35968064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 351 - 454
Target Start/End: Original strand, 35968159 - 35968261
Alignment:
| Q |
351 |
gtatctcaagctattatcatctgtgagcaattcaacatagagaaaaccaagtttaattttcctccaatcaagtatcaaccaaatactttggagtagaagt |
450 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35968159 |
gtatctcaagctattatcatctgtgagcaattcaacatagagaaaaccaagttt-atttttctccaatcaagtatcaaccaaatactttggagtagaagt |
35968257 |
T |
 |
| Q |
451 |
atta |
454 |
Q |
| |
|
|||| |
|
|
| T |
35968258 |
atta |
35968261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 35967779 - 35967832
Alignment:
| Q |
1 |
cgcaataacaaccgtcgtatttgattatttcacataattttttcgataatgata |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35967779 |
cgcaataacaaccgtcgtatttgattatttcacataattttttcgataatgata |
35967832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University