View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4103_low_6 (Length: 298)
Name: NF4103_low_6
Description: NF4103
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4103_low_6 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 7e-89; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 125 - 298
Target Start/End: Original strand, 38186819 - 38186992
Alignment:
| Q |
125 |
cttaccatcgagggtaaaatgtttggtgaaaggggtacgggggagaaggaaaattttgcatagagaaataatccaaaggaaaatgaaagaagcgattatg |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38186819 |
cttaccatcgagggtaaaatgtttggtgaaaggggtacgggggagaaggaaaattttgcatagagaaataatccaaaggaaaatgaaagaagcgattatg |
38186918 |
T |
 |
| Q |
225 |
agaatcaaggccatgaaggttgaaattcaaacaccaattcaatgattagggctcaaaatgaattgtttttattc |
298 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38186919 |
agaatcaaggccatgaaggttgaaattgaaacaccaattcaatgattagtgctcaaaatgaattgtttttattc |
38186992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 4 - 40
Target Start/End: Original strand, 38186697 - 38186733
Alignment:
| Q |
4 |
tcagggtgagcaataaccagcaagacatttctcttcc |
40 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38186697 |
tcagggtgagcaataaccagcaagacatttctcttcc |
38186733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University