View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4105_high_18 (Length: 243)
Name: NF4105_high_18
Description: NF4105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4105_high_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 30556395 - 30556164
Alignment:
| Q |
1 |
gcttctttgttcttgttatatcattgatcattgaaggaggtctccacaaattggctgaggtaattataaatta---atatattaagtagtgcatttatgn |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30556395 |
gcttctttgttcttgttatatcattgatcattgaaggaggtctccacaaattggctgaggtaattataaattactaatatattaagtagtgcatttatga |
30556296 |
T |
|
| Q |
98 |
nnnnnncatatttgagtatactatattcagaaatcaatatatcttgactatgtttaattttcatatgcttcatgatcaattcatatatgcttcagttttt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30556295 |
aaaaaacatatttgagtatactatattcagaaatcaatatatcttgactatgtttaattttcatatgcttcatgatcaattcatatatgcttcagttttt |
30556196 |
T |
|
| Q |
198 |
gaggaaaaagaaaagaaaatccatggggaagg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30556195 |
gaggaaaaagaaaagaaaatccatggggaagg |
30556164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University