View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4105_low_20 (Length: 260)
Name: NF4105_low_20
Description: NF4105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4105_low_20 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 243; Significance: 1e-135; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 6 - 260
Target Start/End: Original strand, 44918390 - 44918644
Alignment:
| Q |
6 |
agcagcacagaggagtgtgatttatgtaatgcaggggtgttttactgtgggccacctgcacttactaaagagcttcgtcaattaggttcggacttttctc |
105 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44918390 |
agcatcactgaggagtgtgatttatgtaatgcaggggtgttttactgtgggccacctgcacttactaaagagcttcgtcaattaggttcggacttttctc |
44918489 |
T |
 |
| Q |
106 |
acaacacaactaccaaatatgatttccacaaggagaatttctagtacttatggtggacattaattattgaagagaaaaaacaacgtggaaacaagatggt |
205 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44918490 |
acaacacaaccaccaaatatgatttccacaaggagaatttctagtacttatggtggacattaattattgaagagaaaaaacaacgtggaaacaagatggt |
44918589 |
T |
 |
| Q |
206 |
cgaccacttttgtcccactactactactatatgaatatgatatgaagagtggccc |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44918590 |
cgaccacttttgtcccactactactactatatgaatatgatatgaagagtggccc |
44918644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 149
Target Start/End: Original strand, 44901979 - 44902011
Alignment:
| Q |
117 |
accaaatatgatttccacaaggagaatttctag |
149 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
44901979 |
accaaatttgatttccacaaggagaatttctag |
44902011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University