View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4105_low_22 (Length: 242)
Name: NF4105_low_22
Description: NF4105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4105_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 19 - 233
Target Start/End: Complemental strand, 4868529 - 4868307
Alignment:
| Q |
19 |
gaagaggggtttaaatatggaatatcataa--------catcaaaatctagagttgtctaaatatatctataaatactgcttgtacttgannnnnnnnac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
4868529 |
gaagaggggtttaaatatggaatatcataagttcataacatcaaaatctagagttgtctaaatatatctataaatactgcttgtacttgaatttttttac |
4868430 |
T |
 |
| Q |
111 |
tatgaaaatcataagtcatttctctcttaaaaacacttctctcaatctaacataactagctaacaagctaaggtttttccgtaatcacattatccttatg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4868429 |
tatgaaaatcataagtcatttctctcttaaaaacacttctctcaatctaacataactagctaacaagctaaggtttttccgtaatcacattatccttatg |
4868330 |
T |
 |
| Q |
211 |
ttggggagattatgtggtctgtg |
233 |
Q |
| |
|
||||||||||||||||| ||||| |
|
|
| T |
4868329 |
ttggggagattatgtggcctgtg |
4868307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 184 - 227
Target Start/End: Complemental strand, 7160095 - 7160052
Alignment:
| Q |
184 |
tttttccgtaatcacattatccttatgttggggagattatgtgg |
227 |
Q |
| |
|
||||||||||||||| || |||||||||||||||| |||||||| |
|
|
| T |
7160095 |
tttttccgtaatcacgttgtccttatgttggggagtttatgtgg |
7160052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University