View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4105_low_27 (Length: 217)
Name: NF4105_low_27
Description: NF4105
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4105_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 14791451 - 14791246
Alignment:
| Q |
1 |
caagtaaaaggagaataattccaccac-------agtgagaatatgatttgtgatcaaagcgtgggttctgtttcatccagcgatgccaatggctggcat |
93 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14791451 |
caagtaaaaggagaataattccaccacgtccagtagtgagaatatgatttgtgatcaaagcgtgggttctgtttcatccagcgatgccaatggctggcat |
14791352 |
T |
 |
| Q |
94 |
aatgtgatcgttctttcaaaagtatactagttattttagtagagttttcttaaactttcattgcaattatcccttttattttactattggatgtaagtat |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14791351 |
aatgtgatcgttctttcaaaagtatactagttattttagtagagttttcttaaactttcattgcaattatcccttttattttactattggatgtaagtat |
14791252 |
T |
 |
| Q |
194 |
gcttat |
199 |
Q |
| |
|
|||||| |
|
|
| T |
14791251 |
gcttat |
14791246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University