View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4106_low_14 (Length: 227)
Name: NF4106_low_14
Description: NF4106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4106_low_14 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 30413714 - 30413491
Alignment:
| Q |
7 |
attcgtgcatctagagcctcttttggttattatt---taaggaatctttaaatttcatacactgccataccaatcccagtatcccacaacgctatattaa |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30413714 |
attcgtgcatctagagcctcttttggttattattatttaaggaatctttaaatttcatacactgccataccaatcccagtatcccacaacgctatattat |
30413615 |
T |
 |
| Q |
104 |
aactattcaactcatattttactccaatgatctgaaaaatatgcaactctaacccacactttttgtcaaaaaagagcaacacttatcactttcatattta |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30413614 |
aactattcaactcatattttactccaatgatctgaaaaatatgcaactctaacccacactttttgtcaaaaaagagcaacacttatcactttcatattta |
30413515 |
T |
 |
| Q |
204 |
tatgaaccaatcttttatttcaat |
227 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
30413514 |
tatgaaccaatcttttatttcaat |
30413491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University