View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4106_low_9 (Length: 248)
Name: NF4106_low_9
Description: NF4106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4106_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 40 - 229
Target Start/End: Complemental strand, 49265349 - 49265160
Alignment:
| Q |
40 |
gtgtgcaggtcaaaagtgttcttaaaaaccgtaagaactttatcaaattggttgaccctctacttcaaggtcgttgtccaatgggaggacttaaacaagc |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49265349 |
gtgtgcaggtcaaaagtgttcttaaaaaccgtaagaactttatcaaattggttgaccctctacttcaaggtcgttgtccaatgggaggacttaaacaagc |
49265250 |
T |
 |
| Q |
140 |
agttgctattgctgcaatgtgtgtgcaaacacaagcttctgcaaggcctctcattggtgaaattgtggatgcacttacatacatgaccag |
229 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49265249 |
agttgctattgcggcaatgtgtgtgcaaacacaagcttctgcaaggcctctcattggtgaaattgtggatgcacttacatacatgaccag |
49265160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University