View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4107_high_17 (Length: 262)
Name: NF4107_high_17
Description: NF4107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4107_high_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 20 - 247
Target Start/End: Complemental strand, 44204114 - 44203886
Alignment:
| Q |
20 |
ccaaataagagattagttcatgcattgaaaagagccacatatagtccattttgtgagttttataataattaattaattggtattaatcaatgcattaatt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44204114 |
ccaaataagagattagttcatgcattgaaaagagccacatatagtccattttgtgagttttataataattaattaattggtattaatcaatgcattaatt |
44204015 |
T |
|
| Q |
120 |
agagatttcttaatatttcgttcgctcatattgagacacaacttgaaaacttcaccacaaaagggatcttttcatgaat-ggttccccgattaatttatt |
218 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||||||| |
|
|
| T |
44204014 |
agagatttcttaacatttcgttcgcccatattgagacacaacttgaaaacttcaccacaaaagggatcttttcatgaatgggatccccaattaatttatt |
44203915 |
T |
|
| Q |
219 |
caaagttggaatttacctgtctttttctt |
247 |
Q |
| |
|
||||||||| ||||||||||||||||||| |
|
|
| T |
44203914 |
caaagttgggatttacctgtctttttctt |
44203886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University