View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4107_high_25 (Length: 227)
Name: NF4107_high_25
Description: NF4107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4107_high_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 9e-60; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 1 - 121
Target Start/End: Complemental strand, 16626760 - 16626640
Alignment:
| Q |
1 |
tcctctctttgcatagtcacttcactatggctattcacttgacctttatttgggagtcaagaggagaagtgagaggagtgctatggagggaatgtgagag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16626760 |
tcctctctttgcatagtcacttcactatggctattcacttgacctttatttgggagtcaagaggagaagtgagaggagtgctatggagggactgtgagag |
16626661 |
T |
|
| Q |
101 |
agggaaatgaagggaatccct |
121 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
16626660 |
agggaaatgaagggaatccct |
16626640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 130 - 225
Target Start/End: Complemental strand, 16626488 - 16626393
Alignment:
| Q |
130 |
aaaaccctatgcaagatggagggctatcaacccttctcatttcctttcttcccccttatcctcaaagtccttccttcgctttctctcctaacccct |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
16626488 |
aaaaccctatgcaagatggagggctatcaacccttctcatttcctttcttcccccttatcctcaaagtccttccctcgctttctctcttaacccct |
16626393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University