View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4107_high_6 (Length: 369)
Name: NF4107_high_6
Description: NF4107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4107_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 2e-77; HSPs: 8)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 14 - 168
Target Start/End: Complemental strand, 32565534 - 32565380
Alignment:
| Q |
14 |
agatggttccaatcttcaatataatttctatagggattcttgccctcaagctgaagatattgtttgttccgctgttaccgatatctactttgatcataga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32565534 |
agatggttccaatcttcaatataatttctatagggattcttgccctcaagctgaagatattgttcgttccgctgttaccgatatctactttgatcataga |
32565435 |
T |
 |
| Q |
114 |
gaccttgcaccttctcttcttcgtctcttctttcatgattgcttcatccacgtaa |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32565434 |
gaccttgcaccttctcttcttcgtctcttctttcatgattgcttcatccaggtaa |
32565380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 14 - 168
Target Start/End: Complemental strand, 32806719 - 32806565
Alignment:
| Q |
14 |
agatggttccaatcttcaatataatttctatagggattcttgccctcaagctgaagatattgtttgttccgctgttaccgatatctactttgatcataga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32806719 |
agatggttccaatcttcaatataatttctatagggattcttgccctcaagctgaagatattgttcgttccgctgttaccgatatctactttgatcataga |
32806620 |
T |
 |
| Q |
114 |
gaccttgcaccttctcttcttcgtctcttctttcatgattgcttcatccacgtaa |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32806619 |
gaccttgcaccttctcttcttcgtctcttctttcatgattgcttcatccaggtaa |
32806565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 143; E-Value: 5e-75
Query Start/End: Original strand, 14 - 168
Target Start/End: Complemental strand, 32815156 - 32815002
Alignment:
| Q |
14 |
agatggttccaatcttcaatataatttctatagggattcttgccctcaagctgaagatattgtttgttccgctgttaccgatatctactttgatcataga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32815156 |
agatggttccaatcttcaatataatttctatagggattcttgccctcaagctgaagatattgttcgttccgctgttaccgatatctactttgatcataga |
32815057 |
T |
 |
| Q |
114 |
gaccttgcaccttctcttcttcgtctcttctttcatgattgcttcatccacgtaa |
168 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
32815056 |
gaccttgcaccttctcttcttcgtcttttctttcatgattgcttcatccaggtaa |
32815002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 14 - 168
Target Start/End: Original strand, 32309301 - 32309455
Alignment:
| Q |
14 |
agatggttccaatcttcaatataatttctatagggattcttgccctcaagctgaagatattgtttgttccgctgttaccgatatctactttgatcataga |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32309301 |
agatggttccaatcttcaatataatttctatagggattcttgccctcaagctgaagataatgttcgttccgctgttaccgatatctactttgatcataga |
32309400 |
T |
 |
| Q |
114 |
gaccttgcaccttctcttcttcgtctcttctttcatgattgcttcatccacgtaa |
168 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
32309401 |
gaccttgcaccttctcttcttcgtcttttctttcatgattgcttcatccaggtaa |
32309455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 14 - 139
Target Start/End: Complemental strand, 32799765 - 32799640
Alignment:
| Q |
14 |
agatggttccaatcttcaatataatttctatagggattcttgccctcaagctgaagatattgtttgttccgctgttaccgatatctactttgatcataga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32799765 |
agatggttccaatcttcaatataatttctatagggattcttgccctcaagctgaagatattgttcgttccgctgttaccgatatctactttgatcataga |
32799666 |
T |
 |
| Q |
114 |
gaccttgcaccttctcttcttcgtct |
139 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
32799665 |
gaccttgcaccttctcttcttcgtct |
32799640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 14 - 163
Target Start/End: Complemental strand, 28215766 - 28215617
Alignment:
| Q |
14 |
agatggttccaatcttcaatataatttctatagggattcttgccctcaagctgaagatattgtttgttccgctgttaccgatatctactttgatcataga |
113 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||| ||||||| |||||||| ||||||||||||||||||| |||| |||||||||| |
|
|
| T |
28215766 |
agatggttccaatcttcgatataatttctataaggattcttgccctgaagctgagaatattgttcgttccgctgttaccgatatttactctgatcataga |
28215667 |
T |
 |
| Q |
114 |
gaccttgcaccttctcttcttcgtctcttctttcatgattgcttcatcca |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28215666 |
gaccttgcaccttctcttcttcgtctcttctttcatgattgcttcatcca |
28215617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 14 - 163
Target Start/End: Original strand, 28220458 - 28220604
Alignment:
| Q |
14 |
agatggttccaatcttcaatataatttctatagggattcttgccctcaagctgaagatattgtttgttccgctgttaccgatatctactttgatcataga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||||||||| |||||||| ||||||||||||||||||| |||||| |||||||| |
|
|
| T |
28220458 |
agatggttccaatcttcaatataatttctataaggtttcttgccctcaagctgagaatattgttcgttccgctgttaccgatatttactttaatcataga |
28220557 |
T |
 |
| Q |
114 |
gaccttgcaccttctcttcttcgtctcttctttcatgattgcttcatcca |
163 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28220558 |
gacc-tgcaccttctcttcttcgtctct--tttcatgattgcttcatcca |
28220604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 125 - 168
Target Start/End: Original strand, 32305344 - 32305387
Alignment:
| Q |
125 |
ttctcttcttcgtctcttctttcatgattgcttcatccacgtaa |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32305344 |
ttctcttcttcgtctcttctttcatgattgcttcatccaggtaa |
32305387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 139; Significance: 1e-72; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 14 - 168
Target Start/End: Original strand, 301447 - 301601
Alignment:
| Q |
14 |
agatggttccaatcttcaatataatttctatagggattcttgccctcaagctgaagatattgtttgttccgctgttaccgatatctactttgatcataga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
301447 |
agatggttccaatcttcaatataatttctatagggattctagccctcaagctgaagatattgttccttccgctgttaccgatatctaccttgatcataga |
301546 |
T |
 |
| Q |
114 |
gaccttgcaccttctcttcttcgtctcttctttcatgattgcttcatccacgtaa |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
301547 |
gaccttgcaccttctcttcttcgtctcttctttcatgattgcttcatccacgtaa |
301601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 211 - 302
Target Start/End: Original strand, 301644 - 301735
Alignment:
| Q |
211 |
tgtgaaaatggagtctttattgttcttcagttatgtggtggaaacgaggtgtctttatttttgtgcattttgcatccaagatcataaattta |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
301644 |
tgtgaaaatggagtctttattgttcttcagttatgtggtggaaacgaggtgtctttatttttgtgcattttgcatccaagattataaattta |
301735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 299 - 351
Target Start/End: Original strand, 301778 - 301830
Alignment:
| Q |
299 |
tttacaggctctatgaaatagtgaatattgatatcctaaattttacaggctct |
351 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
301778 |
tttataggctctatgaaatagtgaatattgatatcctaaattttacaggctct |
301830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University