View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4107_high_9 (Length: 333)
Name: NF4107_high_9
Description: NF4107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4107_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 118; Significance: 4e-60; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 144 - 280
Target Start/End: Original strand, 4475532 - 4475669
Alignment:
| Q |
144 |
tcgctagttgaagacggcgtaagttaactcatgcttggtacccaacatgagttaacttgcgcagggttaattttgaaagtttggatgaaaatgagtaaaa |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4475532 |
tcgctagttgaagacggcgtaagttaactcatgtttggtacccaacatgagttaacttgcgctgggttaattttgaaagtttggatgaaaatgagtaaaa |
4475631 |
T |
 |
| Q |
244 |
ttgaaaggaaaaaagcaa-tttcaaatgcctcaaacac |
280 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
4475632 |
ttgaaaggataaaagcaattttcaaatgcctcaaacac |
4475669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 10 - 117
Target Start/End: Original strand, 4475387 - 4475494
Alignment:
| Q |
10 |
catcatcatacttcaaggtatccacggcaaatggttgatacatgtaagtggcttttaacatgatatatattcgatccttcaactttcatgagcttcaaca |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4475387 |
catcatcatacttcaaggtatccacggcaaatggttgatacatgtaagtggcttttaacatgatatatattcaatccttcaactttcatgagcttcaaca |
4475486 |
T |
 |
| Q |
110 |
taccctta |
117 |
Q |
| |
|
|||||||| |
|
|
| T |
4475487 |
taccctta |
4475494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 191 - 264
Target Start/End: Complemental strand, 38843849 - 38843773
Alignment:
| Q |
191 |
tgagttaacttgcgcaggg-ttaattttgaaagttt-ggatgaaaatgagtaaaattgaaag-gaaaaaagcaattt |
264 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||| || ||| |||||||||||||||||| ||||| |||||||| |
|
|
| T |
38843849 |
tgagttaacttgcgttggggttaattttgaaagtttggggtgagaatgagtaaaattgaaagagaaaagagcaattt |
38843773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 47 - 117
Target Start/End: Original strand, 39313367 - 39313437
Alignment:
| Q |
47 |
atacatgtaagtggcttttaacatgatatatattcgatccttcaactttcatgagcttcaacataccctta |
117 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39313367 |
atacctgtaagtggcttttaacatgatatatagttaatccttcaactttcatgagcttcaacacaccctta |
39313437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University