View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4107_low_11 (Length: 350)
Name: NF4107_low_11
Description: NF4107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4107_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 18 - 204
Target Start/End: Original strand, 23398240 - 23398426
Alignment:
| Q |
18 |
ctctacacctttatttttacgagaaatatttttaaaatatttcatacatgtttagatttacgatgagattgacagaatcaccaatgtcatggtgattttg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23398240 |
ctctacacctttatttttacgagaaatatttttaaaatatttcatacatgtttagatttacgatgagattgacagaatcaccaatgtgatggtgattttg |
23398339 |
T |
 |
| Q |
118 |
tcaaactcacaactgatccaaacgtacacatgtatgcagttccatgaaacaatattatacaagttatttggtggttgcttactatag |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23398340 |
tcaaactcacaactgatccaaacgtacacatgtatgcagttccatgaaacaatattatacatgttatttggtggttgcttactatag |
23398426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 310 - 338
Target Start/End: Original strand, 23398538 - 23398566
Alignment:
| Q |
310 |
aaaagctacccagaacaatgtgatatttt |
338 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
23398538 |
aaaagctacccagaacaatgtgatatttt |
23398566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University