View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4107_low_17 (Length: 303)
Name: NF4107_low_17
Description: NF4107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4107_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 46 - 296
Target Start/End: Original strand, 37100765 - 37101015
Alignment:
| Q |
46 |
aacatcaacaacacaagcaagcataacagttacaatagtactactagtagtgaagtgttgtgttgtgttaattgcaggtggagacagagagagggtagat |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37100765 |
aacatcaacaacacaagcaagcataacagttacagtagtactactagtagtgaagtgttgtgttgtgttaattgcaggtggagacagagagagggtagat |
37100864 |
T |
|
| Q |
146 |
aaagagttaacgtgtgtctctgcaacttaactcagagttttccttcccaatgaaatgaaaatgaatctcactgcccttcttggtctacgcaattactgct |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37100865 |
aaagagttaacgtgtgtctctgcaacttaactcagagttttccttcccaatgaaatgaaaatgaatctcactgcccttcttggtctacgcaattactgct |
37100964 |
T |
|
| Q |
246 |
gatcattctactgtttatgagtactactaacactatttgttgcctatgcta |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37100965 |
gatcattctactgtttatgagtactactaacactatttgttgcctatgcta |
37101015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University