View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4107_low_26 (Length: 251)
Name: NF4107_low_26
Description: NF4107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4107_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 19466945 - 19467161
Alignment:
| Q |
18 |
atttacttctttctcttcccacttttcacacctccgcaaaaccctaatttcacgtacatccacaatgaaaaggaagagaagttcttcttctctcaaatcc |
117 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19466945 |
attttcttctttctcttcccacttttcacacctccgcaaaaccctaatttcac----atccacaatgaaaaggaagagaagttcttcttctctcaaatcc |
19467040 |
T |
|
| Q |
118 |
tcacagcaaatacaaatcgtttcttcttccatcaaaacatattcatatttacctgatgaatgctgggaatcgatcttcaggttcatcatcaaccagtacc |
217 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19467041 |
tcacaacaaatacaaatggtttcttcttccatcaaaacatattcatatttacctgatgaatgctgggaatcgatcttcaggttcatcatcaaccagtacc |
19467140 |
T |
|
| Q |
218 |
aaacagttcctcacaggttct |
238 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
19467141 |
aaacagttcctcacagtttct |
19467161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 44; Significance: 4e-16; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 25 - 105
Target Start/End: Original strand, 10168614 - 10168692
Alignment:
| Q |
25 |
tctttctcttcccacttttcacacctccgcaaaaccctaatttcacgtaca-tccacaatgaaaaggaagagaagttcttct |
105 |
Q |
| |
|
|||||||||||||| |||||| |||| |||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
10168614 |
tctttctcttcccaattttcattcctc---aaaaccctaatttcacatacaatccacaatgaaaaggaagagaagttcttct |
10168692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 25 - 105
Target Start/End: Original strand, 10176139 - 10176217
Alignment:
| Q |
25 |
tctttctcttcccacttttcacacctccgcaaaaccctaatttcacgtaca-tccacaatgaaaaggaagagaagttcttct |
105 |
Q |
| |
|
|||||||||||||| |||||| |||| |||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
10176139 |
tctttctcttcccaattttcattcctc---aaaaccctaatttcacatacaatccacaatgaaaaggaagagaagttcttct |
10176217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 56 - 88
Target Start/End: Original strand, 10167144 - 10167176
Alignment:
| Q |
56 |
aaaccctaatttcacgtacatccacaatgaaaa |
88 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
10167144 |
aaaccctaatttcacatacatccacaatgaaaa |
10167176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 152 - 196
Target Start/End: Original strand, 53759956 - 53760000
Alignment:
| Q |
152 |
aaacatattcatatttacctgatgaatgctgggaatcgatcttca |
196 |
Q |
| |
|
||||| ||||| ||||||||||||| ||||||||||| ||||||| |
|
|
| T |
53759956 |
aaacacattcagatttacctgatgagtgctgggaatctatcttca |
53760000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University