View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4107_low_33 (Length: 230)
Name: NF4107_low_33
Description: NF4107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4107_low_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 10 - 217
Target Start/End: Original strand, 48167482 - 48167689
Alignment:
| Q |
10 |
catcatcatatagagggttgtgttgtccatagagatatcaaggtaagtgtgatgaagttaatctggaatggattctgcacttaattgggaatgattagaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48167482 |
catcatcatatagagggttgtgttgtccatagagatatcaaggtaagtgtgatgaagttaatctggaatggattctgcacttaattgggaatgattagaa |
48167581 |
T |
 |
| Q |
110 |
aatgttttcttaatgccttgtattgattttattgtttagcttacaaacattcttttgactgagaaatatgaagccaaactgtcggattttggattgtcaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48167582 |
aatgttttcttaatgccttgtattgattttattgtttagcttacaaacattcttttgactgagaaatatgaagccaaactgtcggattttggattgtcaa |
48167681 |
T |
 |
| Q |
210 |
ggatgatg |
217 |
Q |
| |
|
|||||||| |
|
|
| T |
48167682 |
ggatgatg |
48167689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University