View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4107_low_35 (Length: 226)
Name: NF4107_low_35
Description: NF4107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4107_low_35 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 16 - 208
Target Start/End: Original strand, 17695695 - 17695887
Alignment:
| Q |
16 |
agagatttgggtcccataacaatgacttgtaatgaaacagagtgaagtggaggaaattgtggggatgtaaccttactatgtgatggtgagtctactgagt |
115 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17695695 |
agagatttgggtcccataacaatgaattgtaatgaaacaaagtgaagtggaggaaattgtggggatgtaaccttactatgtgatgatgagtctactgagt |
17695794 |
T |
 |
| Q |
116 |
gattgctcttctgctgcactgcgttggaattatcagaaaacatgtgtagagaaaaattcttttcaaataaataaaagtcttgcataccacgac |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17695795 |
gattgctcttctgctgcactgcgttggaattatcagaaaacatgtgtagagaaaaattcttttcaaataaataaaagtcttgcataccacgac |
17695887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 116 - 177
Target Start/End: Original strand, 6665213 - 6665274
Alignment:
| Q |
116 |
gattgctcttctgctgcactgcgttggaattatcagaaaacatgtgtagagaaaaattcttt |
177 |
Q |
| |
|
|||||||||| |||||||||| |||||| ||| |||| |||| | ||||||||||||||||| |
|
|
| T |
6665213 |
gattgctcttttgctgcactgtgttggatttaacagataacaagggtagagaaaaattcttt |
6665274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 116 - 177
Target Start/End: Original strand, 43305413 - 43305474
Alignment:
| Q |
116 |
gattgctcttctgctgcactgcgttggaattatcagaaaacatgtgtagagaaaaattcttt |
177 |
Q |
| |
|
|||||||||| |||||||||| |||||||||| |||| |||| | | ||||||||||||||| |
|
|
| T |
43305413 |
gattgctcttttgctgcactgtgttggaattaacagataacaagggaagagaaaaattcttt |
43305474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University