View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4107_low_36 (Length: 226)
Name: NF4107_low_36
Description: NF4107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4107_low_36 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 16549289 - 16549512
Alignment:
| Q |
1 |
tcatcaaataattgacgaaatttaacaaaattcttaatggtttggtgaacattcaggatgaagacaacactttactttttgtgtgcaatacctagatcct |
100 |
Q |
| |
|
|||| ||| |||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16549289 |
tcataaaacaattgatgaagtttaacaaaattcttaatggtttggtgaacattcaggatgaagacaacactttactttttgtgtgcaatacctagatcct |
16549388 |
T |
|
| Q |
101 |
ttgagcactttaaggaaggataccatgctttatgctaaagaactcaccatcaccttggatgaagtnnnnnnnnnnncacaaagaaccaagaagttaacca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
16549389 |
ttgagcactttaaggaaggataccatgctttatgctaaagaactcaccatcaccctggatgaagt--aaaaaaaaacacaaagaaccaagaagttaacca |
16549486 |
T |
|
| Q |
201 |
actccaaggcttaaagtttgatgata |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
16549487 |
actccaaggcttaaagtttgatgata |
16549512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University