View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4107_low_37 (Length: 220)
Name: NF4107_low_37
Description: NF4107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4107_low_37 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 25976058 - 25975851
Alignment:
| Q |
1 |
acgaaagaaaataacataagaacgacctacggagataccaaaagtcgtaaactatattctttttcactaaaaacaaatgaatctctttataacctctaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25976058 |
acgaaagaaaataacataagaacgacctacggagataccaaaagtcgtaaactatattctttttcactaaaaacaaatgaatctctttataacctctaaa |
25975959 |
T |
|
| Q |
101 |
agtcacaaatatttttggatgcaaaagatcgacattgttttctcaacatggatgacttctatggataaagacatgcatggagttttagttttagtttctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25975958 |
agtcacaaatatttttggatgcaaaagatcgacattgttttctcaacatggatgacttctatggataaagacatgcatagagttttagttttagtttctt |
25975859 |
T |
|
| Q |
201 |
tttgcctt |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
25975858 |
tttgcctt |
25975851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University