View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4107_low_6 (Length: 434)
Name: NF4107_low_6
Description: NF4107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4107_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 356; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 46 - 429
Target Start/End: Complemental strand, 27699298 - 27698915
Alignment:
| Q |
46 |
atgtctctctaaccacaacttaatggtggttgaggctgcatcagctgtatttggctgcagctttctgtaatatcaaggatcatgatgctacgtaaccaag |
145 |
Q |
| |
|
|||||||| |||||| ||||| | || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27699298 |
atgtctctgtaaccataacttgacggcggttgaggctgcatcagctgtatttggctgcagctttctgtaatatcaaggatcatgatgctacgtaaccaag |
27699199 |
T |
|
| Q |
146 |
atttaaaatcttggtattcattatcattgatggttagtataaaaaatgattttgcaggttgcattcagaaccaaggtattccatcccaacattaacagca |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27699198 |
atttaaaatcttggtattcattatcattgatggttagtataaaaaatgattttgcaggttgcattcagaaccaaggtattccatcccaacattaacagca |
27699099 |
T |
|
| Q |
246 |
atggcaatatttgcctagatatactcaaagaacaatggagtcctgctctgacaatatccaaggtcatgttattgtgaaccattcttcgttgacgccgtta |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27699098 |
atggcaatatttgcctagatatactcaaagaacaatggagtcctgctctgacaatatccaaggtcatgttattgtgaaccattcctcgttgacgccgtta |
27698999 |
T |
|
| Q |
346 |
gtttctacccattttatataaagatgctgaatgattgttaaaaatcatgatgatacaggtactgctctccatatgttctctgct |
429 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27698998 |
gtttctatccattttatataaagatgctgaatgattgttaaaaatcatgatgatacaggtactgctctccatatgttctctgct |
27698915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 198 - 309
Target Start/End: Complemental strand, 28199392 - 28199281
Alignment:
| Q |
198 |
tgcaggttgcattcagaaccaaggtattccatcccaacattaacagcaatggcaatatttgcctagatatactcaaagaacaatggagtcctgctctgac |
297 |
Q |
| |
|
||||||||||||| || || ||||||||||| || ||||| ||||||||||| | |||||| || || || || || ||||||||||| || || ||||| |
|
|
| T |
28199392 |
tgcaggttgcatttaggactaaggtattccacccaaacatcaacagcaatggaagtatttgtctcgacattcttaaggaacaatggagccccgcactgac |
28199293 |
T |
|
| Q |
298 |
aatatccaaggt |
309 |
Q |
| |
|
|| |||||||| |
|
|
| T |
28199292 |
catttccaaggt |
28199281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University