View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4107_low_7 (Length: 396)
Name: NF4107_low_7
Description: NF4107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4107_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 64; Significance: 7e-28; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 193 - 295
Target Start/End: Complemental strand, 43135352 - 43135247
Alignment:
| Q |
193 |
gatgaaaatggtgattttctctacacaaaatttcggccccctctctctatgagttgttgggtac---gagggagtgacttgatcaccaagagtgtaaaaa |
289 |
Q |
| |
|
|||||||||||||||||| | || ||||||||||||||||||||||||||||||||||||||| || ||||||||||| |||||||||||| ||||| |
|
|
| T |
43135352 |
gatgaaaatggtgattttggccactcaaaatttcggccccctctctctatgagttgttgggtacttagaaggagtgacttggtcaccaagagtgcaaaaa |
43135253 |
T |
 |
| Q |
290 |
ttaggt |
295 |
Q |
| |
|
|||||| |
|
|
| T |
43135252 |
ttaggt |
43135247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 267 - 330
Target Start/End: Complemental strand, 43598516 - 43598452
Alignment:
| Q |
267 |
cttgatcaccaagagtgtaaaaattaggt-aagtggtgggtaagaaagggtagtttggaattttg |
330 |
Q |
| |
|
|||| |||||||||||| ||||||||||| ||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
43598516 |
cttggtcaccaagagtgcaaaaattaggttaagtggtggataagaaagggtagtttgaaattttg |
43598452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 257 - 329
Target Start/End: Original strand, 13079630 - 13079702
Alignment:
| Q |
257 |
gagggagtgacttgatcaccaagagtgtaaaaattaggtaa-gtggtgggtaagaaagggtagtttggaatttt |
329 |
Q |
| |
|
|||| ||| ||||| |||||||||||| ||||||||||| | |||| | |||||||||||||||||| |||||| |
|
|
| T |
13079630 |
gaggaagtaacttggtcaccaagagtg-aaaaattaggttacgtggggagtaagaaagggtagtttgaaatttt |
13079702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University