View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4109_high_2 (Length: 390)
Name: NF4109_high_2
Description: NF4109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4109_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 255; Significance: 1e-142; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 349
Target Start/End: Original strand, 36878098 - 36878438
Alignment:
| Q |
1 |
acttatggtctctcagacccgcacatgtgaaacaatctttatccttggcaagatgtccaaccagtaatgtagcttttgtttttgcctgttttatggattc |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36878098 |
acttatggtctcccagacccgcacatgtgaaacaatctttatccttggcaa--------accagtaatgtagcttttgtttttgcctgttttatggattc |
36878189 |
T |
|
| Q |
101 |
agatttttattccaaatatacaactatatcattcttccacacatatgctactgatataagatcatcaatacccagtaactcacatcaatttttattatgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36878190 |
agatttttattccaaatatacaactatatcattcttccacacatatgctactgatataagatcatcaatacccagtaactcacatcaatttttattatgc |
36878289 |
T |
|
| Q |
201 |
ttgtgagatttaacagc-nnnnnnnnnnccaaagatcatcaatacccaacgaaagttttaacaagaatacgcaaatatccgatcaaattgcaaaataata |
299 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36878290 |
ttgtgagatttaacagcaaaaaaaaaaaccaaagatcatcaatacccgacgaaagttttaacaagaatacgcaaatatccgatcaaa-tgcaaaataata |
36878388 |
T |
|
| Q |
300 |
tattaaccgccaaccaatggtagataactttcaccacaaacaaaaaatgg |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
36878389 |
tattaaccgccaaccaatggtagataactttcaccaaaaaacaaaaatgg |
36878438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 73 - 110
Target Start/End: Complemental strand, 36879632 - 36879595
Alignment:
| Q |
73 |
cttttgtttttgcctgttttatggattcagatttttat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36879632 |
cttttgtttttgcctgttttatggattcagatgtttat |
36879595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 351 - 383
Target Start/End: Original strand, 36878723 - 36878755
Alignment:
| Q |
351 |
agataacttcgtacgcacaaattttgatgatgt |
383 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
36878723 |
agataacttcgtacgcacaaattttaatgatgt |
36878755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University